Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

tIVR
(Plasmid #122663)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122663 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5293
  • Total vector size (bp) 5863
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein expression, 8 hour incubation at 30 degree with 0.4 mM IPTG is optimal.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tIVR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    570
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tIVR was a gift from Robert Cohen (Addgene plasmid # 122663 ; http://n2t.net/addgene:122663 ; RRID:Addgene_122663)
  • For your References section:

    High-affinity free ubiquitin sensors for quantifying ubiquitin homeostasis and deubiquitination. Choi YS, Bollinger SA, Prada LF, Scavone F, Yao T, Cohen RE. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0469-9. doi: 10.1038/s41592-019-0469-9. 10.1038/s41592-019-0469-9 PubMed 31308549