pHLSec2-irisin-his
(Plasmid #122729)

• Purpose: Expresses in mammalian cells (HEK293):glycosylated and secreted irisin-his
• Depositing Lab: Harold Erickson
• Publication: Albrecht et al Sci Rep. 2015 Mar 9;5:8889. doi: 10.1038/srep08889.

Backbone

• Vector backbone: pHLSec2
• Backbone size w/o insert (bp): 4600
• Total vector size (bp): 4962
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: irisin (ectodomain of FNDC5)
• Alt name: FNDC5
• Species: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), B. taurus (bovine)
• Insert Size (bp): 441
• GenBank ID: NM_027402.3
• Entrez Gene: Fndc5 (a.k.a. 1500001L03Rik, PeP, Pxp)
• Tags / Fusion Proteins:
  • his (C terminal on insert)
  • signal sequence for secretion (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTACAGCTCCTGGGCAACGTG
• 3′ sequencing primer: TCAGTGGTATTTGTGAGCCAGGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please Note: Addgene NGS is unable to fully resolve the CAG promoter sequence. Please refer to the depositor's sequence for this section of the plasmid.