Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pACT1:Cas9-GFP, U6:sgTK
(Plasmid #122852)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122852 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 2700
  • Total vector size (bp) 9981
  • Vector type
    CRISPR ; Cas9-GFP plasmid for genome editing of Cryptosporidium parasites

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9-GFP
  • Species
    streptococcus pyogenes
  • Insert Size (bp)
    4956
  • Promoter Cryptosporidium parvum actin
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCAACACTTAACCTTTCAGT
  • 3′ sequencing primer TCAGTTCTATTCTCATTTGAAAGCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    U6-sgTK
  • Species
    Cryptosporidium parvum
  • Insert Size (bp)
    727
  • Promoter Cryptosporidium parvum U6

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTAGGCGCCAAGACCCAG
  • 3′ sequencing primer CTATAGTGTCACCTAAATAGCTTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACT1:Cas9-GFP, U6:sgTK was a gift from David Sibley (Addgene plasmid # 122852 ; http://n2t.net/addgene:122852 ; RRID:Addgene_122852)
  • For your References section:

    A Stem-Cell-Derived Platform Enables Complete Cryptosporidium Development In Vitro and Genetic Tractability. Wilke G, Funkhouser-Jones LJ, Wang Y, Ravindran S, Wang Q, Beatty WL, Baldridge MT, VanDussen KL, Shen B, Kuhlenschmidt MS, Kuhlenschmidt TB, Witola WH, Stappenbeck TS, Sibley LD. Cell Host Microbe. 2019 Jun 18. pii: S1931-3128(19)30252-5. doi: 10.1016/j.chom.2019.05.007. 10.1016/j.chom.2019.05.007 PubMed 31231046