pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
(Plasmid
#122986)
-
PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV hSyn
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCh-IRES-SspB(micro)-BoNT/B(147-441)
-
SpeciesSynthetic
-
Insert Size (bp)2600
-
MutationSspB contains R73Q "micro" mutation, BoNT/B contains Y365A mutation
- Promoter human synapsin
-
Tags
/ Fusion Proteins
- mCh
- mCh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer actcagcgctgcctcagt
- 3′ sequencing primer ccacatagcgtaaaaggagcaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySspB was obtained from Dr. Brian Kuhlman's lab (University of North Carolina, Chapel Hill) BoNT/B was a gift from Dr Thomas Binz (Hannover Medical School)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A) was a gift from Matthew Kennedy (Addgene plasmid # 122986 ; http://n2t.net/addgene:122986 ; RRID:Addgene_122986) -
For your References section:
A Photoactivatable Botulinum Neurotoxin for Inducible Control of Neurotransmission. Liu Q, Sinnen BL, Boxer EE, Schneider MW, Grybko MJ, Buchta WC, Gibson ES, Wysoczynski CL, Ford CP, Gottschalk A, Aoto J, Tucker CL, Kennedy MJ. Neuron. 2019 Jan 15. pii: S0896-6273(19)30003-0. doi: 10.1016/j.neuron.2019.01.002. 10.1016/j.neuron.2019.01.002 PubMed 30704911