pBT100-neo
(Plasmid
#123137)
-
PurposeGolden Gate donor vector for the assembly of EGFP-based mammalian recombinase reporters.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBT100
- Backbone size w/o insert (bp) 1700
- Total vector size (bp) 3000
-
Vector typeSynthetic Biology ; Golden Gate donor vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeomycin, poly-A terminator
- Promoter none
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCCTTTGAGTGAGCTGATACCG
- 3′ sequencing primer GAAAAGTGCCACCTAAATTGTAAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Golden gate donor vector which, in conjunction with pCALNL-EGFP-BsaI acceptor vector and two dsDNA recombinase targets, assembles to form a fluorescent EGFP transfectable reporter. Donor vector contains neomycin resistance cassette and poly-A terminator.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBT100-neo was a gift from David Liu (Addgene plasmid # 123137 ; http://n2t.net/addgene:123137 ; RRID:Addgene_123137) -
For your References section:
High-resolution specificity profiling and off-target prediction for site-specific DNA recombinases. Bessen JL, Afeyan LK, Dancik V, Koblan LW, Thompson DB, Leichner C, Clemons PA, Liu DR. Nat Commun. 2019 Apr 26;10(1):1937. doi: 10.1038/s41467-019-09987-0. 10.1038/s41467-019-09987-0 PubMed 31028261