-
PurposeMammalian expression of murine cytokine IL-12 under CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN1
-
Backbone manufacturerclonTech
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5685
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMurine IL12 tandem p40 p35
-
Alt namemIL-12
-
Alt namep40
-
Alt namep35
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1773
-
GenBank ID16159 16160
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site PvuI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mIL12-N1 was a gift from Jordan Green (Addgene plasmid # 123139 ; http://n2t.net/addgene:123139 ; RRID:Addgene_123139) -
For your References section:
In situ genetic engineering of tumors for long-lasting and systemic immunotherapy. Tzeng SY, Patel KK, Wilson DR, Meyer RA, Rhodes KR, Green JJ. Proc Natl Acad Sci U S A. 2020 Feb 7. pii: 1916039117. doi: 10.1073/pnas.1916039117. 10.1073/pnas.1916039117 PubMed 32034097