Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mIL12-N1
(Plasmid #123139)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123139 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N1
  • Backbone manufacturer
    clonTech
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5685
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Murine IL12 tandem p40 p35
  • Alt name
    mIL-12
  • Alt name
    p40
  • Alt name
    p35
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1773
  • GenBank ID
    16159 16160
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PvuI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mIL12-N1 was a gift from Jordan Green (Addgene plasmid # 123139 ; http://n2t.net/addgene:123139 ; RRID:Addgene_123139)
  • For your References section:

    In situ genetic engineering of tumors for long-lasting and systemic immunotherapy. Tzeng SY, Patel KK, Wilson DR, Meyer RA, Rhodes KR, Green JJ. Proc Natl Acad Sci U S A. 2020 Feb 7. pii: 1916039117. doi: 10.1073/pnas.1916039117. 10.1073/pnas.1916039117 PubMed 32034097