Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

A102-GRM
(Plasmid #123291)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123291 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE
  • Total vector size (bp) 6099
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Glo3
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    230
  • Mutation
    373-459
  • Entrez Gene
    GLO3 (a.k.a. YER122C)
  • Promoter T5
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xma1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer tctggtatgccgtgcgtactgcggtgatca
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAACAAATCCAGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A102-GRM was a gift from Blanche Schwappach (Addgene plasmid # 123291 ; http://n2t.net/addgene:123291 ; RRID:Addgene_123291)
  • For your References section:

    Dissection of GTPase-activating proteins reveals functional asymmetry in the COPI coat of budding yeast. Arakel EC, Huranova M, Estrada AF, Rau EM, Spang A, Schwappach B. J Cell Sci. 2019 Aug 29;132(16). pii: jcs.232124. doi: 10.1242/jcs.232124. 10.1242/jcs.232124 PubMed 31331965