-
PurposegRNA expression plasmid for CRISPR mutagenesis in Drosophila (with mini-white transformation marker).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCFD3-dU6-3gRNA (Addgene 49410)
-
Backbone manufacturerFillip Port
- Total vector size (bp) 7998
-
Modifications to backboneReplacement of vermilion transformation marker with mini-white gene (with BbsI sites mutated)
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6:3-gRNA
-
Alt nameU6:3-sgRNA
-
SpeciesD. melanogaster (fly)
-
GenBank ID
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CTGGCGAAAGGGGGATGTGCTG
- 3′ sequencing primer TAAGGTATGCAGGTGTGTAAGTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe modified mini-white cassette was provided by Dr Fillip Port from CRISPRflydesign, who has given permission for us to deposit this plasmid.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When describing the use of this plasmid in publications, please state that it is derived from pCFD3 and cite:
Port et al. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014 Jul 22;111(29):E2967-76. doi: 10.1073/pnas.1405500111
In pCFD3.1, the BbsI sites have been mutated in mini-white, which allows use of the remaining BbsI sites for gRNA cloning (using the protocol for pCFD3 (https://www.crisprflydesign.org/plasmids/)).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3.1-w-dU6:3gRNA was a gift from Simon Bullock (Addgene plasmid # 123366 ; http://n2t.net/addgene:123366 ; RRID:Addgene_123366)