Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #123615)


Item Catalog # Description Quantity Price (USD)
Plasmid 123615 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    pSQT817 (Addgene #53373)
  • Backbone size w/o insert (bp) 4843
  • Total vector size (bp) 10768
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    R. norvegicus (rat), Synthetic; Streptococcus pyogenes, Bacillus subtilis bacteriophage PBS1
  • Insert Size (bp)
  • Mutation
    R33A/K34A in rAPOBEC1, D10A in SpCas9
  • GenBank ID
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer CAGAGGGAAAAAGATCTCAGTGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410) was a gift from Keith Joung (Addgene plasmid # 123615 ; ; RRID:Addgene_123615)
  • For your References section:

    Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors. Grunewald J, Zhou R, Garcia SP, Iyer S, Lareau CA, Aryee MJ, Joung JK. Nature. 2019 Apr 17. pii: 10.1038/s41586-019-1161-z. doi: 10.1038/s41586-019-1161-z. 10.1038/s41586-019-1161-z PubMed 30995674