Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSLHDR02_EGFP_tCD8
(Plasmid #124061)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124061 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Original
  • Backbone size w/o insert (bp) 2440
  • Total vector size (bp) 5503
  • Vector type
    Mouse Targeting ; Human Targeting
  • Selectable markers
    GFP, tCD8

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    708
  • Promoter Human UbC promoter modified

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGTGTTAGACTAGTAAATTGTCCGC
  • 3′ sequencing primer TCAAGTCCGCCATGCCCGAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tCD8
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    627
  • Promoter Human UbC promoter modified

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer ccctcATTCTTGGGGTTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLHDR02_EGFP_tCD8 was a gift from Matthew Porteus (Addgene plasmid # 124061 ; http://n2t.net/addgene:124061 ; RRID:Addgene_124061)
  • For your References section:

    Efficient scarless genome editing in human pluripotent stem cells. Ikeda K, Uchida N, Nishimura T, White J, Martin RM, Nakauchi H, Sebastiano V, Weinberg KI, Porteus MH. Nat Methods. 2018 Dec;15(12):1045-1047. doi: 10.1038/s41592-018-0212-y. Epub 2018 Nov 30. 10.1038/s41592-018-0212-y PubMed 30504872