spCas9-NLS-MAV
(Plasmid #124212)

• Purpose: SpCas9-NLS 17 amino acid linker to monoavidin (SpCas9-NLS-MAV)
• Depositing Lab: Uri David Akavia
• Publication: Roche et al CRISPR J. 2018 Dec;1:414-430. doi: 10.1089/crispr.2018.0045.

Backbone

• Vector backbone: pEC-K-MBP
• Backbone size w/o insert (bp): 5745
• Total vector size (bp): 10990
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: cas9
• Alt name: Csn1
• Species: Streptococcus pyogenes
• Insert Size (bp): 5745
• Promoter: T7
• Tags / Fusion Proteins:
  • MBP (N terminal on backbone)
  • His6 (N terminal on backbone)
  • two copies of SV40NLS (C terminal on insert)
  • TEV Cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GATGAAGCCCTGAAAGACGCGCAG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • SpCas9-NLS-MAV.gb
• A portion of this plasmid was derived from a plasmid made by: pRSET-mSA (which we bought from Addgene), and pMJ915 and pMJ806 (which we got from our collaborator at McGill). All three of them contributed to the final plasmid.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry