-
PurposeMulti-species CRISPR/Cas9 coexpression system, optimized for Golden Gate cloning of gRNA targets
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUDP002
-
Backbone manufacturerTU Delft
- Backbone size w/o insert (bp) 9106
- Total vector size (bp) 10233
-
Modifications to backboneInsert 1 cloned by Gibson assembly between the existing ScTDH3 promoter and ScCYC1 terminator
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHH-BsaI
-
Alt nameHH-gRNA-HDV expression cassette
-
SpeciesSynthetic
-
Insert Size (bp)1136
-
MutationgRNA expression cassette from pUDP002 modified to allow cloning of gRNA targets by Golden Gate assembly
- Promoter TDH3 promoter from S.cerevisiae (already present in backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCTCTCTCTGATTTGGAAAAAGCTGAA
- 3′ sequencing primer TACACGCGTTTGTACAGAAAAAAAAGAAAAATTTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The same patent and IP restrictions as in pUDP002 apply here.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCC001 was a gift from John Morrissey (Addgene plasmid # 124451 ; http://n2t.net/addgene:124451 ; RRID:Addgene_124451) -
For your References section:
Biological Parts for Kluyveromyces marxianus Synthetic Biology. Rajkumar AS, Varela JA, Juergens H, Daran JG, Morrissey JP. Front Bioeng Biotechnol. 2019 May 7;7:97. doi: 10.3389/fbioe.2019.00097. eCollection 2019. 10.3389/fbioe.2019.00097 PubMed 31134195