pFD116
(Plasmid
#124769)
-
PurposepFD116 carries dcas9 controlled by an aTc-inducible Ptet promoter, a sgRNA controlled constitutively from PpflB S. aureus promoter to clone a guide between two BsaI sites and oriT on pLZ12 vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLZ12
- Backbone size w/o insert (bp) 3729
- Total vector size (bp) 9131
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePtet
-
Insert Size (bp)855
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGCACCCATTAGTTCAGTTACCATCACGGAAAAAGGTTATGCTG
- 3′ sequencing primer CCATTTTTGCCTCCTATATGCCTCCGAATTCGATATCACT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedcas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4134
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAATTCGGAGGCATATAGGAGGCAAAAATGGATAAGAAATA
- 3′ sequencing primer TCAGTCACCTCCTAGCTGACTCAA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePpflB sgRNA BsaI
-
SpeciesSynthetic; synthetic fragment
-
Insert Size (bp)505
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCTTTATGAAACACGCATTGA
- 3′ sequencing primer ATCCAATTTTCGTTTGTAGTAGAAACAGACGAAGAATCCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFD116 was a gift from David Bikard (Addgene plasmid # 124769 ; http://n2t.net/addgene:124769 ; RRID:Addgene_124769) -
For your References section:
Gene silencing with CRISPRi in bacteria and optimization of dCas9 expression levels. Depardieu F, Bikard D. Methods. 2019 Aug 1. pii: S1046-2023(18)30497-3. doi: 10.1016/j.ymeth.2019.07.024. 10.1016/j.ymeth.2019.07.024 PubMed 31377338