Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUW-tetO-GATA2
(Plasmid #125028)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125028 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUW-tetO
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GATA binding protein 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1443
  • GenBank ID
    NM_001145661.1
  • Entrez Gene
    GATA2 (a.k.a. DCML, IMD21, MONOMAC, NFE1B)
  • Promoter TRE-mCMV
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TCCACGCTGTTTTGACCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-tetO-GATA2 was a gift from Filipe Pereira (Addgene plasmid # 125028 ; http://n2t.net/addgene:125028 ; RRID:Addgene_125028)
  • For your References section:

    Cooperative Transcription Factor Induction Mediates Hemogenic Reprogramming. Gomes AM, Kurochkin I, Chang B, Daniel M, Law K, Satija N, Lachmann A, Wang Z, Ferreira L, Ma'ayan A, Chen BK, Papatsenko D, Lemischka IR, Moore KA, Pereira CF. Cell Rep. 2018 Dec 4;25(10):2821-2835.e7. doi: 10.1016/j.celrep.2018.11.032. 10.1016/j.celrep.2018.11.032 PubMed 30517869