Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCI-syn-fRCaMP1
(Plasmid #125245)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125245 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 3703
  • Total vector size (bp) 5088
  • Modifications to backbone
    CMV promoter replaced by synapsin promoter
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fRCaMP1
  • Alt name
    jRCaMP1a RS-1
  • Species
    R. norvegicus (rat), G. gallus (chicken); E. quadricolor (Sea anemone)
  • Insert Size (bp)
    1385
  • Mutation
    W44Y
  • Promoter synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer TCCACCATGGTGCAGAACGAGCTTGCTCTTAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene #61562

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

fRCaMP1 is the W44Y variant of the jRCaMP1a gene cloned from the pGP-CMV vector (#61562) published by Dana et al. 2016.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-syn-fRCaMP1 was a gift from Katalin Torok (Addgene plasmid # 125245 ; http://n2t.net/addgene:125245 ; RRID:Addgene_125245)
  • For your References section:

    The kinetic mechanisms of fast-decay red-fluorescent genetically encoded calcium indicators. Kerruth S, Coates C, Durst CD, Oertner TG, Torok K. J Biol Chem. 2019 Mar 15;294(11):3934-3946. doi: 10.1074/jbc.RA118.004543. Epub 2019 Jan 16. 10.1074/jbc.RA118.004543 PubMed 30651353