lentiCRISPR v2-sgBAP1-1
(Plasmid
#125837)
-
PurposeKO BAP1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiCRISPR V2
-
Backbone manufacturerFeng Zhang
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBAP1 (BRCA1 associated protein 1)
-
gRNA/shRNA sequenceCACCGACGAGCAGGGTGAAGAGGCC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)25
-
Entrez GeneBAP1 (a.k.a. HUCEP-13, KURIS, TPDS1, UBM2, UCHL2, UVM2, hucep-6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgBAP1-1 was a gift from Boyi Gan (Addgene plasmid # 125837 ; http://n2t.net/addgene:125837 ; RRID:Addgene_125837) -
For your References section:
BAP1 links metabolic regulation of ferroptosis to tumour suppression. Zhang Y, Shi J, Liu X, Feng L, Gong Z, Koppula P, Sirohi K, Li X, Wei Y, Lee H, Zhuang L, Chen G, Xiao ZD, Hung MC, Chen J, Huang P, Li W, Gan B. Nat Cell Biol. 2018 Oct;20(10):1181-1192. doi: 10.1038/s41556-018-0178-0. Epub 2018 Sep 10. 10.1038/s41556-018-0178-0 PubMed 30202049