1
Browse > Scot Wolfe > Meng et al > pH3U3-mcs
Plasmid 12609: pH3U3-mcs

  • Multiple cloning site in His3 Ura3 reporter plasmid

  • 44

  • S. cerevisiae (budding yeast)

  • DQ515893

  • pH3U3
    (Search Vector Database)

  • Bacterial Expression

  • 5790

  • NotI

  • No

  • EcoRI

  • No

  • CAAATATGTATCCGCTCATGAC List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • Low Copy

  • URA3, HIS3

  • View sequences (2)

  • View map

  • Scot Wolfe

  • MTA

Comments: 

Please note that the cloning information for this plasmid has been corrected as of 1/14/09. The 5' cloning site was changed from MluI to NotI.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng et al (Nat Biotechnol. 2005 Aug . 23(8):988-94. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12609" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only