Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pB-puro-mU6-RtcAshRNA1
(Plasmid #126613)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126613 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RtcA shRNA-1
  • gRNA/shRNA sequence
    TGGCACCACAGATCGATTATAC
  • Species
    Synthetic
  • Promoter mouse U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer CAGCACAAAAGGAAACTCACCCTAACTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB-puro-mU6-RtcAshRNA1 was a gift from Xiaozhong Wang (Addgene plasmid # 126613 ; http://n2t.net/addgene:126613 ; RRID:Addgene_126613)
  • For your References section:

    The cyclic phosphodiesterase CNP and RNA cyclase RtcA fine-tune noncanonical XBP1 splicing during ER stress. Unlu I, Lu Y, Wang X. J Biol Chem. 2018 Dec 14;293(50):19365-19376. doi: 10.1074/jbc.RA118.004872. Epub 2018 Oct 24. 10.1074/jbc.RA118.004872 PubMed 30355738