-
PurposeCre-dependent expression of SomArchon under CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126943 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-FLEX
- Backbone size w/o insert (bp) 5052
- Total vector size (bp) 6873
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSomArchon
-
SpeciesSynthetic
-
Insert Size (bp)1821
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-FLEX-SomArchon was a gift from Edward Boyden (Addgene plasmid # 126943 ; http://n2t.net/addgene:126943 ; RRID:Addgene_126943) -
For your References section:
Population imaging of neural activity in awake behaving mice. Piatkevich KD, Bensussen S, Tseng HA, Shroff SN, Lopez-Huerta VG, Park D, Jung EE, Shemesh OA, Straub C, Gritton HJ, Romano MF, Costa E, Sabatini BL, Fu Z, Boyden ES, Han X. Nature. 2019 Oct;574(7778):413-417. doi: 10.1038/s41586-019-1641-1. Epub 2019 Oct 9. 10.1038/s41586-019-1641-1 PubMed 31597963