Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1(+)/AUU-nLuc-3XFLAG-CL1/PEST
(Plasmid #127319)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127319 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Total vector size (bp) 6154
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nanoLuciferase
  • Alt name
    nLuc
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3xFLAG (C terminal on insert)
    • CL1/PEST (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)/AUU-nLuc-3XFLAG-CL1/PEST was a gift from Jeremy Wilusz (Addgene plasmid # 127319 ; http://n2t.net/addgene:127319 ; RRID:Addgene_127319)
  • For your References section:

    Ribosome queuing enables non-AUG translation to be resistant to multiple protein synthesis inhibitors. Kearse MG, Goldman DH, Choi J, Nwaezeapu C, Liang D, Green KM, Goldstrohm AC, Todd PK, Green R, Wilusz JE. Genes Dev. 2019 Jun 6. pii: gad.324715.119. doi: 10.1101/gad.324715.119. 10.1101/gad.324715.119 PubMed 31171704