pX330-sgR26
(Plasmid #127376)

• Purpose: Used for contransfection with pR26- and pR26-CMVconst-derived constructs to mediate CRISPR/Cas9 genomic insertion into the murine ROSA26 safe harbor locus.
• Depositing Lab: Lance Miller
• Publication: Routh et al Front Immunol. 2020 Feb 13;11:57. doi: 10.3389/fimmu.2020.00057. eCollection 2020.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Backbone manufacturer: Feng Zhang laboratory
• Backbone size w/o insert (bp): 8506
• Total vector size (bp): 8509
• Modifications to backbone: Insertion of gRNA targeting intron 1 of the mouse ROSA26 locus.
• Vector type: Mouse Targeting, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ROSA26
• gRNA/shRNA sequence: ACTCCAGTCTTTCTAGAAGA
• Species: M. musculus (mouse)
• Entrez Gene: Gt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: not available
• 3′ sequencing primer: tagagccatttgtctgcagaattgg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone vector was received from Addgene (Addgene #42230)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry