FLAG-MBP1-E322TAG-E309C-W340A-CAAX.pcDNA3-k
(Plasmid
#127409)
-
PurposeExpresses MBP in mammalian cells. Amber codon at AA# 322 as a noncanonical amino acid incorporation site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5370
- Total vector size (bp) 6711
-
Modifications to backboneAddition of Kozak Sequence
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMaltose Binding Protein
-
Alt nameMBP
-
Insert Size (bp)1341
-
MutationAmino acid mutations: E322 to Amber codon, E309C and W340A
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- CAAX (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GACAGTGGGAGTGGCACCTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs) and was codon optimized for mammalian cell expression.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
W340A was introduced to reduce the affinity of MBP for endogenous ligands.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-MBP1-E322TAG-E309C-W340A-CAAX.pcDNA3-k was a gift from Sharona Gordon (Addgene plasmid # 127409 ; http://n2t.net/addgene:127409 ; RRID:Addgene_127409) -
For your References section:
Visualizing conformational dynamics of proteins in solution and at the cell membrane. Gordon SE, Munari M, Zagotta WN. Elife. 2018 Jun 20;7. pii: 37248. doi: 10.7554/eLife.37248. 37248 [pii] PubMed 29923827