pCFD3-frame_selector_0
(Plasmid
#127553)
-
PurposeDrosophila expression of frame selector sgRNA 0 that targets CRISPaint site for homology-independent knock-in
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127553 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCFD3
-
Backbone manufacturerFillip Port and Simon Bullock
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA frame 0
-
gRNA/shRNA sequenceGCCAGTACCCAAAAAGCGGG
- Promoter dU6:3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer acctactcagccaagaggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3-frame_selector_0 was a gift from Norbert Perrimon (Addgene plasmid # 127553 ; http://n2t.net/addgene:127553 ; RRID:Addgene_127553) -
For your References section:
Gene Knock-Ins in Drosophila Using Homology-Independent Insertion of Universal Donor Plasmids. Bosch JA, Colbeth R, Zirin J, Perrimon N. Genetics. 2019 Nov 4. pii: genetics.119.302819. doi: 10.1534/genetics.119.302819. 10.1534/genetics.119.302819 PubMed 31685521