pACYC-TtCas6-4xcrRNA4.5
(Plasmid
#127764)
-
PurposeFor expression of T. thermophilus Csm complex in E. coli (crRNA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACYCDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3920
- Total vector size (bp) 4977
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameSynthetic CRISPR array containing four identical T. thermophilus spacers
-
SpeciesSynthetic; Thermus thermophilus HB8
-
Insert Size (bp)340
-
GenBank IDAP008227.1 (144467 to 144542)
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCas6A
-
Alt nameTTHA0078
-
Alt nameCas6 endonuclease
-
SpeciesSynthetic; Thermus thermophilus HB8
-
Insert Size (bp)4977
-
MutationCodon optimized for expression in E. coli
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC-TtCas6-4xcrRNA4.5 was a gift from Jennifer Doudna (Addgene plasmid # 127764 ; http://n2t.net/addgene:127764 ; RRID:Addgene_127764) -
For your References section:
Target preference of Type III-A CRISPR-Cas complexes at the transcription bubble. Liu TY, Liu JJ, Aditham AJ, Nogales E, Doudna JA. Nat Commun. 2019 Jul 5;10(1):3001. doi: 10.1038/s41467-019-10780-2. 10.1038/s41467-019-10780-2 PubMed 31278272