-
PurposeExpresses R. toruloides codon-optimized SpCas9 under PGK1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBRIA
-
Backbone manufacturerZhao lab
- Backbone size w/o insert (bp) 13658
- Total vector size (bp) 17762
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9-NLS3
-
SpeciesRhodosporidium toruloides
-
Insert Size (bp)4182
- Promoter pPGK1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAAATTGACGCTTAGACAAC
- 3′ sequencing primer TATATCCTGTCAAACACTGATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NM9-SpCas9-NLS3 was a gift from Huimin Zhao (Addgene plasmid # 128177 ; http://n2t.net/addgene:128177 ; RRID:Addgene_128177) -
For your References section:
Development of a CRISPR/Cas9 system for high efficiency multiplexed gene deletion in Rhodosporidium toruloides. Schultz JC, Cao M, Zhao H. Biotechnol Bioeng. 2019 Apr 30. doi: 10.1002/bit.27001. 10.1002/bit.27001 PubMed 31038202