pCIneoLuc-TEAD4
(Plasmid
#128335)
-
PurposeVector for LUMIER assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128335 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTEAD4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1300
-
GenBank ID7004
-
Entrez GeneTEAD4 (a.k.a. EFTR-2, RTEF1, TCF13L1, TEF-3, TEF3, TEFR-1, hRTEF-1B)
- Promoter CMV
-
Tag
/ Fusion Protein
- Luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gataggcacctattggtcttactgacat
- 3′ sequencing primer Gaacctgaaacataaaatgaat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert for TEAD4 contains L552F and S862G compared to the reference NP_003204.2 that do not impact function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIneoLuc-TEAD4 was a gift from Yutaka Hata (Addgene plasmid # 128335 ; http://n2t.net/addgene:128335 ; RRID:Addgene_128335) -
For your References section:
Novel YAP1 Activator, Identified by Transcription-Based Functional Screen, Limits Multiple Myeloma Growth. Maruyama J, Inami K, Michishita F, Jiang X, Iwasa H, Nakagawa K, Ishigami-Yuasa M, Kagechika H, Miyamura N, Hirayama J, Nishina H, Nogawa D, Yamamoto K, Hata Y. Mol Cancer Res. 2018 Feb;16(2):197-211. doi: 10.1158/1541-7786.MCR-17-0382. Epub 2017 Oct 23. 10.1158/1541-7786.MCR-17-0382 PubMed 29061667