pQCXIP-mCherry-Halo-YAP1
(Plasmid
#128336)
-
PurposeRetrovirus construct to express mCherry-Halo-YAP1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYAP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1520
-
GenBank ID10413
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry and Halo-tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TACTTTCAGAGCGATAACGCG
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PCR was performed with the primers (H3244, 50-caattggcagaaatcggtactggctttccatc-30 and H3245, 50-acgcgtgaattccgcgttatcgctctgaaagta-30) on pHTN-Halo-tag vector (Promega) to amplify Halo-tag. The PCR product was digested with MfeI/MluI and ligated into EcoRI/MluI of pCIneomCherry to generate pCIneomCherry-Halo. MluI/NotI fragment from pCIneoFH-YAP1 was ligated into MluI/NotI sites of pCIneomCherry-Halo to generate pCIneomCherry-Halo-YAP1. NheI/NotI fragment from pCIneomCherry-Halo-YAP1 was ligated into XbaI/NotI of pQCXIP-EF to generate pQCXIP-mCherry-Halo-YAP1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIP-mCherry-Halo-YAP1 was a gift from Yutaka Hata (Addgene plasmid # 128336 ; http://n2t.net/addgene:128336 ; RRID:Addgene_128336) -
For your References section:
Novel YAP1 Activator, Identified by Transcription-Based Functional Screen, Limits Multiple Myeloma Growth. Maruyama J, Inami K, Michishita F, Jiang X, Iwasa H, Nakagawa K, Ishigami-Yuasa M, Kagechika H, Miyamura N, Hirayama J, Nishina H, Nogawa D, Yamamoto K, Hata Y. Mol Cancer Res. 2018 Feb;16(2):197-211. doi: 10.1158/1541-7786.MCR-17-0382. Epub 2017 Oct 23. 10.1158/1541-7786.MCR-17-0382 PubMed 29061667