pCDF-5xT7-TtCsm
(Plasmid #128572)

• Purpose: For expression of T. thermophilus Csm in E. coli (Csm1-5)
• Depositing Lab: Jennifer Doudna
• Publication: Liu et al Nat Commun. 2019 Jul 5;10(1):3001. doi: 10.1038/s41467-019-10780-2.

Backbone

• Vector backbone: pCDF-1b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 3419
• Total vector size (bp): 9479
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Csm1
• Alt name: TTHB147
• Alt name: Cas10
• Species: Synthetic; Thermus thermophilus
• Insert Size (bp): 2433
• Mutation: Codon-optimized for expression in E. coli, XhoI site added after stop codon
• Promoter: T7 promoter, lac operator
• Tag / Fusion Protein:
  • Met-Ala-Ser (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ttgcgcgagaagattgtg

Gene/Insert 2

• Gene/Insert name: Csm2, Csm3, Csm4, Csm5
• Alt name: TTHB148, TTHB149, TTHB150, TTHB151
• Species: Synthetic; Thermus thermophilus HB8
• Insert Size (bp): 3627
• Mutation: Codon optimized for expression in E. coli
• Promoter: T7 promoter, lac operator
• Tag / Fusion Protein:
  • HRV 3C protease cleavage site and 10xHis tag on Csm5 (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: AvrII (not destroyed)
• 5′ sequencing primer: GTGAAGGTCGTGATCTGGCA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry