-
PurposeExpresses 12xgp41 peptide array (MoonTag peptide array), followed by 12xgcn4 peptide array (SunTag peptide array), kif18b gene and 24 repeats of PP7 hairpins in 3’ UTR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA4/TO
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name12xMoonTag-12xSunTag
-
Alt name12xgp41-12xgcn4
- Promoter Pcmv
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namekinesin family member 18b
-
SpeciesH. sapiens (human)
-
Entrez GeneKIF18B
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid has 24 repeats of PP7 hairpins in 3'UTR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
12xMoonTag-12xSunTag-kif18b-24xPP7 was a gift from Marvin Tanenbaum (Addgene plasmid # 128606 ; http://n2t.net/addgene:128606 ; RRID:Addgene_128606) -
For your References section:
Multi-Color Single-Molecule Imaging Uncovers Extensive Heterogeneity in mRNA Decoding. Boersma S, Khuperkar D, Verhagen BMP, Sonneveld S, Grimm JB, Lavis LD, Tanenbaum ME. Cell. 2019 Jun 5. pii: S0092-8674(19)30499-4. doi: 10.1016/j.cell.2019.05.001. 10.1016/j.cell.2019.05.001 PubMed 31178119