pSK267
(Plasmid #129272)

• Purpose: "ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed protein
• Depositing Lab: Ahmad Khalil
• Publication: Newby et al Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19.

Backbone

• Vector backbone: pGAN147
• Backbone manufacturer: Gregory Newby
• Total vector size (bp): 8954
• Vector type: Yeast Expression
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-VP16-ZF 43-8-NES
• Species: Synthetic
• Promoter: SUP35
• Tag / Fusion Protein:
  • 6xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (destroyed during cloning)
• 3′ cloning site: HindIII (destroyed during cloning)
• 5′ sequencing primer: catcttctcttgaaagactccattgtactg

Resource Information

• Supplemental Documents:
  • pSK267-GAN147-NAT-Neon-43-8.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is the zinc finger only control for the yTRAP sensor plasmid. Linearize with NotI-HF enzyme prior to integration into the yeast genome. pSK267 integrates into the HO locus, and can be selected for using nourseothricin, it constitutively produces high mNeonGreen reporter output.