Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGL3-Basic-Rab18-sfGFP(N) HDR template
(Plasmid #129415)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129415 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 5277
  • Modifications to backbone
    Only plasmid backbone for amplification in E.coli was used.
  • Vector type
    Mammalian Expression, CRISPR, TALEN ; Endogenous tagging HDR template
  • Selectable markers
    No selection marker on this plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAB18 HDR template
  • Alt name
    RAB18LI1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2248
  • GenBank ID
    22931
  • Entrez Gene
    RAB18 (a.k.a. RAB18LI1, WARBM3)
  • Tag / Fusion Protein
    • sfGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer agtgcaggtgccagaacatt
  • 3′ sequencing primer ggaaggagctgactgggttg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector was designed and generated by Shiqian Li (Elina Ikonen Lab).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Basic-Rab18-sfGFP(N) HDR template was a gift from Elina Ikonen (Addgene plasmid # 129415 ; http://n2t.net/addgene:129415 ; RRID:Addgene_129415)
  • For your References section:

    Seipin Facilitates Triglyceride Flow to Lipid Droplet and Counteracts Droplet Ripening via Endoplasmic Reticulum Contact. Salo VT, Li S, Vihinen H, Holtta-Vuori M, Szkalisity A, Horvath P, Belevich I, Peranen J, Thiele C, Somerharju P, Zhao H, Santinho A, Thiam AR, Jokitalo E, Ikonen E. Dev Cell. 2019 Jun 6. pii: S1534-5807(19)30388-0. doi: 10.1016/j.devcel.2019.05.016. 10.1016/j.devcel.2019.05.016 PubMed 31178403