Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

NmMetQ WT
(Plasmid #129647)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129647 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET21b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5474
  • Total vector size (bp) 6222
  • Modifications to backbone
    Removed the 6x His Tag + Stop Codon (caccaccaccaccaccactga) at C Terminal end of the insert
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    metQ Gene
  • Alt name
    Methionine Substrate Binding Protein
  • Species
    Neisseria meningitidis
  • Insert Size (bp)
    741
  • GenBank ID
    CP020421.2
  • Promoter T7 Promoter
  • Tags / Fusion Proteins
    • 10x Histidine Tag (N terminal on insert)
    • Enterokinase (N terminal on insert)
    • pelB signal sequence (N terminal on insert)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NmMetQ WT was a gift from Douglas Rees (Addgene plasmid # 129647 ; http://n2t.net/addgene:129647 ; RRID:Addgene_129647)
  • For your References section:

    Structures of the Neisseria meningitides methionine-binding protein MetQ in substrate-free form and bound to l- and d-methionine isomers. Nguyen PT, Lai JY, Kaiser JT, Rees DC. Protein Sci. 2019 Jul 26. doi: 10.1002/pro.3694. 10.1002/pro.3694 PubMed 31348565