MADR pDonor smFP-HA (dark) WPRE
(Plasmid
#131007)
-
PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of SM_FP-HA, a cytoplasmic fluorescent protein which includes multiple HA epitope tags
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMADR pDonor
- Total vector size (bp) 6621
-
Vector typeMammalian Expression, Cre/Lox, Synthetic Biology ; Mosaic analysis for dual recombinase-mediated cassette exchange (MADR) donor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesmFP-HA WPRE
-
SpeciesSynthetic
-
Mutation"dark" variant with GGG fluorphore compared with TYG "bright" variant
- Promoter none (4x polyA to mitigate episomal expression)
-
Tag
/ Fusion Protein
- HA - 10 total HA epitope tages
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer MADR-MCSF (TCGACCTGCAGCCCAAGCTA)
- 3′ sequencing primer WPRE-R (addgene) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byaddgene Plasmid #59759
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MADR pDonor smFP-HA (dark) WPRE was a gift from Joshua Breunig (Addgene plasmid # 131007 ; http://n2t.net/addgene:131007 ; RRID:Addgene_131007) -
For your References section:
Rapid Generation of Somatic Mouse Mosaics with Locus-Specific, Stably Integrated Transgenic Elements. Kim GB, Rincon Fernandez Pacheco D, Saxon D, Yang A, Sabet S, Dutra-Clarke M, Levy R, Watkins A, Park H, Abbasi Akhtar A, Linesch PW, Kobritz N, Chandra SS, Grausam K, Ayala-Sarmiento A, Molina J, Sedivakova K, Hoang K, Tsyporin J, Gareau DS, Filbin MG, Bannykh S, Santiskulvong C, Wang Y, Tang J, Suva ML, Chen B, Danielpour M, Breunig JJ. Cell. 2019 Sep 19;179(1):251-267.e24. doi: 10.1016/j.cell.2019.08.013. 10.1016/j.cell.2019.08.013 PubMed 31539496