Target-AID (pRZ762)
(Plasmid #131300)

• Purpose: CAG promoter expression plasmid for NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-pmCDA1(R187W with reference to NCBI ABO15149.1)-NLS-UGI-P2A-EGFP.
• Depositing Lab: Keith Joung
• Publication: Grunewald et al Nat Biotechnol. 2019 Sep 2. pii: 10.1038/s41587-019-0236-6. doi: 10.1038/s41587-019-0236-6.

Backbone

• Vector backbone: CAG
• Backbone manufacturer: pSQT817 (Addgene #53373)
• Backbone size w/o insert (bp): 4843
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-pmCDA1(R187W with reference to NCBI ABO15149.1)-NLS-UGI-P2A-EGFP
• Species: Streptococcus pyogenes, Bacillus subtilis bacteriophage PBS1, SV40, Petromyzon marinus
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCTGCTAACCATGTTCATGCC
• 3′ sequencing primer: CAGAGGGAAAAAGATCTCAGTGG

Resource Information

• Supplemental Documents:
  • Target-AID (pRZ762).gb
• A portion of this plasmid was derived from a plasmid made by: based on Addgene #79620
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry