Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCRISPR-aBEST
(Plasmid #131464)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131464 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGM1190
  • Backbone size w/o insert (bp) 6971
  • Total vector size (bp) 12452
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Streptomyces codon optimized spCas9n (D10A)
  • Species
    Synthetic; Streptomyces
  • Insert Size (bp)
    4104
  • GenBank ID
    KR011748
  • Promoter tipA

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcggcagcagcggcggctcggacaagaagtactccatcgg
  • 3′ sequencing primer ggggatcctctagaaagctttcagtcgccgccgagctggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    streptomyces codon optimized tadA
  • Species
    Synthetic; Streptomyces
  • Insert Size (bp)
    1191
  • Promoter tipA

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAGAGAAGGGAGCGGACAtatgagcgaggtcgagttctc
  • 3′ sequencing primer cgagccgccgctgctgccgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR-aBEST was a gift from Tilmann Weber (Addgene plasmid # 131464 ; http://n2t.net/addgene:131464 ; RRID:Addgene_131464)
  • For your References section:

    Highly efficient DSB-free base editing for streptomycetes with CRISPR-BEST. Tong Y, Whitford CM, Robertsen HL, Blin K, Jorgensen TS, Klitgaard AK, Gren T, Jiang X, Weber T, Lee SY. Proc Natl Acad Sci U S A. 2019 Oct 8;116(41):20366-20375. doi: 10.1073/pnas.1913493116. Epub 2019 Sep 23. 10.1073/pnas.1913493116 PubMed 31548381