Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Thy1.1-muSOX D219A
(Plasmid #131704)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131704 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 5949
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Thy1.1-muSOX
  • Alt name
    CD90.1
  • Species
    MHV68
  • Insert Size (bp)
    2016
  • Mutation
    Aspartic acid 219 mutated to an alanine
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ttgtttattgcagcttataatggtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy1.1-muSOX D219A was a gift from Britt Glaunsinger (Addgene plasmid # 131704 ; http://n2t.net/addgene:131704 ; RRID:Addgene_131704)
  • For your References section:

    Changes in mRNA abundance drive shuttling of RNA binding proteins, linking cytoplasmic RNA degradation to transcription. Gilbertson S, Federspiel JD, Hartenian E, Cristea IM, Glaunsinger B. Elife. 2018 Oct 3;7. pii: 37663. doi: 10.7554/eLife.37663. 10.7554/eLife.37663 PubMed 30281021