Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
(Plasmid #131757)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131757 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONR221 P3-P2
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2555
  • Total vector size (bp) 3267
  • Vector type
    Synthetic Biology ; pMAGIC Gateway Entry plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRE#2 Sp/xCas9 gRNA
  • gRNA/shRNA sequence
    CTATCAGTGATAGAGAACGA
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer M13F (-20)
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sp/xCas9 gRNA TRE#2 targets the pTight promoter (Clontech) 1x and has no known targets in the h/m/r genome. This gRNA can be used with SpCas9 and its derivatives (e.g. xCas9(3.7)).

Cloned by ligating annealed SpCas9 TRE#2 oligonucleotides into KK701 (Addgene 121842)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA was a gift from Christopher Newgard (Addgene plasmid # 131757 ; http://n2t.net/addgene:131757 ; RRID:Addgene_131757)
  • For your References section:

    Creation of versatile cloning platforms for transgene expression and dCas9-based epigenome editing. Haldeman JM, Conway AE, Arlotto ME, Slentz DH, Muoio DM, Becker TC, Newgard CB. Nucleic Acids Res. 2018 Dec 27. pii: 5264291. doi: 10.1093/nar/gky1286. 10.1093/nar/gky1286 PubMed 30590691