pMH48
(Plasmid
#131861)
-
PurposeProduces holo-Cph1* in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDFDuet-1
-
Backbone manufacturerNovagen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCph1(1-514,Y263F)-RGD-His6-Cys
-
Alt nameCph1*
-
SpeciesSynthetic; Synechocystis PCC 6803
-
Insert Size (bp)1602
- Promoter T7 promoter-1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATCTCGACGCTCTCCCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHO1
-
SpeciesSynechocystis PCC 6803
-
Insert Size (bp)723
- Promoter T7 promoter-2
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTACACGGCCGCATAATC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePcyA
-
SpeciesSynechocystis PCC 6803
-
Insert Size (bp)747
- Promoter T7 promoter-2
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GGGTTATGCTAGTTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH48 was a gift from Wilfried Weber (Addgene plasmid # 131861 ; http://n2t.net/addgene:131861 ; RRID:Addgene_131861) -
For your References section:
Production of Phytochromes by High-Cell-Density E. coli Fermentation. Horner M, Gerhardt K, Salavei P, Hoess P, Harrer D, Kaiser J, Tabor JJ, Weber W. ACS Synth Biol. 2019 Sep 26. doi: 10.1021/acssynbio.9b00267. 10.1021/acssynbio.9b00267 PubMed 31526004