GS2.1/EC
(Plasmid #132568)

• Purpose: sgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).
• Depositing Lab: Mathias Pribil
• Publication: Behrendorff et al Physiol Plant. 2020 Feb 25. doi: 10.1111/ppl.13079.

Backbone

• Vector backbone: pH2GW7
• Backbone manufacturer: https://gateway.psb.ugent.be
• Backbone size w/o insert (bp): 8820
• Total vector size (bp): 16355
• Vector type: Plant Expression, CRISPR, Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: egg cell promoter, Cas9-mApple, pds3 sgRNA
• Alt name: Cas9-mApple fusion protein
• Alt name: sgRNA targeting A. thaliana pds3
• Alt name: Arabidopsis egg cell promoter
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 7396
• Promoter: A. thaliana egg cell promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atcggtgcgggcctcttcgctattacgccaGAATAAAAGCATTTGCGTTTGGT
• 3′ sequencing primer: TCTTCAAAAGTACCACAGCGCTTA

Resource Information

• Supplemental Documents:
  • GS2.1_EC.gb
• A portion of this plasmid was derived from a plasmid made by: The PDS3 gRNA was amplified from pUC119-gRNA, a gift from Jen Sheen (Addgene plasmid # 52255 ; http://n2t.net/addgene:52255 ; RRID:Addgene_52255). Cas9 was amplified from pFGC-pcoCas9, a gift from Jen Sheen (Addgene plasmid # 52256 ; http://n2t.net/addgene:52256 ; RRID:Addgene_52256).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Egg cell promoters amplified directly from A. thaliana leaf tissue based on the promoters in Addgene plasmid #71288, described in doi: 10.1186/s13059-015-0715-0 Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint.