pTBL716 4xHRE-YB-TATA-Cas9-ODD-T2A-TdT
(Plasmid
#132667)
-
PurposeExpresses hypoxia-inducible Cas9 and TdT in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132667 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6847
- Total vector size (bp) 13012
-
Modifications to backboneUsed only the regions of the backbone required for propagation in bacteria. Cloned in homology flanks to allow integration at the AAVS1 locus in human cells. Within these flanks are insulators, the insert, and pCMV driving blasticidin resistance.
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-ODD-T2A-TdT
-
Alt nameCas9
-
Alt nameTdT
-
SpeciesH. sapiens (human); Streptococcus pyogenes
-
Insert Size (bp)5730
-
GenBank IDNM_004088.3
-
Entrez GeneDNTT (a.k.a. TDT)
- Promoter 4xHRE_YB TATA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cctccagggatcctgtgtcc
- 3′ sequencing primer aggagcaacatagttaagaatacc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe 4xHRE_YB TATA promoter was obtained from Yvonne Chen (Addgene plasmid #117399). Cas9 was obtained from George Church (Addgene plasmid #41815). The ODD domain was obtained from William Kaelin (Addgene plasmid #19365). The blasticidin resistance gene was obtained from Eric Campeau and Paul Kaufman (Addgene plasmid #17451).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insulator sequence is described in Liu et al., 2015, doi: 10.1038/nbt.3062.
To integrate in human cells, digest with MluI and Eam1105I and co-transfect with Addgene plasmids 126447 and 65772.
Please visit https://www.biorxiv.org/content/10.1101/639120v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL716 4xHRE-YB-TATA-Cas9-ODD-T2A-TdT was a gift from Chang Liu (Addgene plasmid # 132667 ; http://n2t.net/addgene:132667 ; RRID:Addgene_132667) -
For your References section:
Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928