pTBL716 4xHRE-YB-TATA-Cas9-ODD-T2A-TdT
(Plasmid #132667)

• Purpose: Expresses hypoxia-inducible Cas9 and TdT in mammalian cells.
• Depositing Lab: Chang Liu
• Publication: Loveless et al Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 6847
• Total vector size (bp): 13012
• Modifications to backbone: Used only the regions of the backbone required for propagation in bacteria. Cloned in homology flanks to allow integration at the AAVS1 locus in human cells. Within these flanks are insulators, the insert, and pCMV driving blasticidin resistance.
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9-ODD-T2A-TdT
• Alt name: Cas9
• Alt name: TdT
• Species: H. sapiens (human); Streptococcus pyogenes
• Insert Size (bp): 5730
• GenBank ID: NM_004088.3
• Entrez Gene: DNTT (a.k.a. TDT)
• Promoter: 4xHRE_YB TATA

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cctccagggatcctgtgtcc
• 3′ sequencing primer: aggagcaacatagttaagaatacc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The 4xHRE_YB TATA promoter was obtained from Yvonne Chen (Addgene plasmid #117399). Cas9 was obtained from George Church (Addgene plasmid #41815). The ODD domain was obtained from William Kaelin (Addgene plasmid #19365). The blasticidin resistance gene was obtained from Eric Campeau and Paul Kaufman (Addgene plasmid #17451).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insulator sequence is described in Liu et al., 2015, doi: 10.1038/nbt.3062.

To integrate in human cells, digest with MluI and Eam1105I and co-transfect with Addgene plasmids 126447 and 65772.

Please visit https://www.biorxiv.org/content/10.1101/639120v2 for bioRxiv preprint.