AAV8-hSyn-flex-miR30-eGFP-shCrh
(Plasmid #132715)

• Purpose: Encodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Crh gene which encodes corticotropin releasing factor
• Depositing Lab: Robert Messing
• Publication: Pomrenze et al Cell Rep. 2019 Oct 1;29(1):13-21.e4. doi: 10.1016/j.celrep.2019.08.083.

Backbone

• Vector backbone: pAAV-hSyn-flex-miR30
• Backbone manufacturer: Addgene Plasmid # 67845
• Backbone size w/o insert (bp): 4811
• Total vector size (bp): 5950
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GFP-shCrh
• Alt name: GFP-shCrh fragment from pPRIME-CMV-GFP-shCrh(1) vector
• Species: R. norvegicus (rat)
• Insert Size (bp): 1138
• GenBank ID: NM_031019
• Entrez Gene: Crh (a.k.a. CRF)
• Promoter: Synapsin 1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: TGCCTGAGAGCGCAGTCG
• 3′ sequencing primer: AGCAGCGTATCCACATAGCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry