Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pU6-Sp-pegRNA-HEK3_CTT_ins
(Plasmid #132778)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 132778 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pU6
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HEK3_CTT_ins pegRNA
  • gRNA/shRNA sequence
    GGCCCAGACTGAGCACGTGA
  • Species
    Synthetic
  • Insert Size (bp)
    821
  • Mutation
    See manuscript
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert size: 122 bp.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-Sp-pegRNA-HEK3_CTT_ins was a gift from David Liu (Addgene plasmid # 132778 ; http://n2t.net/addgene:132778 ; RRID:Addgene_132778)
  • For your References section:

    Search-and-replace genome editing without double-strand breaks or donor DNA. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Nature. 2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi: 10.1038/s41586-019-1711-4. 10.1038/s41586-019-1711-4 PubMed 31634902