BE3-hA3A-R128A
(Plasmid
#132944)
-
PurposeGene editing. See Gene/Insert section of the plasmid page for targeting sequence cloned into this plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132944 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerFeng Zhang Lab (Addgene#: 42230)
-
Vector typeMammalian Expression, CRISPR ; Base editor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBE3-hA3A(R128A)
-
gRNA/shRNA sequenceGGCCCAGACTGAGCACGTGA
-
SpeciesSynthetic
-
Insert Size (bp)7937
-
MutationBE3-hA3A(R128A)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BE3-hA3A-R128A was a gift from Hui Yang (Addgene plasmid # 132944 ; http://n2t.net/addgene:132944 ; RRID:Addgene_132944) -
For your References section:
Off-target RNA mutation induced by DNA base editing and its elimination by mutagenesis. Zhou C, Sun Y, Yan R, Liu Y, Zuo E, Gu C, Han L, Wei Y, Hu X, Zeng R, Li Y, Zhou H, Guo F, Yang H. Nature. 2019 Jul;571(7764):275-278. doi: 10.1038/s41586-019-1314-0. Epub 2019 Jun 10. 10.1038/s41586-019-1314-0 PubMed 31181567