This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p-eGFP-beta 2 CP
(Plasmid #13298)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 13298 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    p EGFP-C1
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    capping protein beta 2 subunit
  • Alt name
    actin capping protein
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Capzb (a.k.a. 1700120C01Rik, AI325129, CPB1, CPB2, CPbeat2, CPbeta1, CPbeta2, Cappb1)
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ECO R1 (unknown if destroyed)
  • 3′ cloning site Sac II (unknown if destroyed)
  • 5′ sequencing primer GENE SEQ cctcatcaggtccaaggcgcagtcc VECTOR SEQUENCE (CAT # 6479-1
  • 3′ sequencing primer GGTCACATAACAGTTTGCATC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-eGFP-beta 2 CP was a gift from John Cooper (Addgene plasmid # 13298)
  • For your References section:

    Visualization and molecular analysis of actin assembly in living cells. Schafer DA, Welch MD, Machesky LM, Bridgman PC, Meyer SM, Cooper JA. J Cell Biol. 1998 Dec 28. 143(7):1919-30. 10.1083/jcb.143.7.1919 PubMed 9864364