-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep EGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecapping protein beta 2 subunit
-
Alt nameactin capping protein
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1047
-
GenBank IDU10407
-
Entrez GeneCapzb (a.k.a. 1700120C01Rik, AI325129, CPB, CPB1, CPB2, CPbeat2, CPbet, CPbeta1, CPbeta2, Cap, Cappb1)
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ECO R1 (unknown if destroyed)
- 3′ cloning site Sac II (unknown if destroyed)
- 5′ sequencing primer GENE SEQ cctcatcaggtccaaggcgcagtcc VECTOR SEQUENCE (CAT # 6479-1
- 3′ sequencing primer GGTCACATAACAGTTTGCATC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-eGFP-beta 2 CP was a gift from John Cooper (Addgene plasmid # 13298 ; http://n2t.net/addgene:13298 ; RRID:Addgene_13298) -
For your References section:
Visualization and molecular analysis of actin assembly in living cells. Schafer DA, Welch MD, Machesky LM, Bridgman PC, Meyer SM, Cooper JA. J Cell Biol. 1998 Dec 28. 143(7):1919-30. 10.1083/jcb.143.7.1919 PubMed 9864364