-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDEST6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 7000
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsDB3.1 (Invitrogen)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHIS3 reporter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTAAAACGACGGCCAGT (M13FW)
- 3′ sequencing primer GGGACCACCCTTTAAAGAGA (HIS293RV) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the ccdB cassette in the author's map (click on 'View map') is shown in the reverse orientation.
Y1H Destination vector that can be used in conventional Gateway LR cloning reactions. This vector contains a Gateway cassette with AttR4 and AttL1 recombination sites and a HIS3 reporter gene. For more information and protocols, see Deplancke et al. 2004 Genome Res 14(10B):2093 and Deplancke et al. 2006 CSH Protocols.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMW#2 was a gift from Marian Walhout (Addgene plasmid # 13349 ; http://n2t.net/addgene:13349 ; RRID:Addgene_13349) -
For your References section:
A gene-centered C. elegans protein-DNA interaction network. Deplancke B, Mukhopadhyay A, Ao W, Elewa AM, Grove CA, Martinez NJ, Sequerra R, Doucette-Stamm L, Reece-Hoyes JS, Hope IA, Tissenbaum HA, Mango SE, Walhout AJ. Cell. 2006 Jun 16. 125(6):1193-205. 10.1016/j.cell.2006.04.038 PubMed 16777607