px459-RhebL1 sgRNA
(Plasmid #133769)

• Purpose: Expresses Cas9 and human RhebL1 sgRNA
• Depositing Lab: Shawn Ferguson
• Publication: Angarola et al Mol Biol Cell. 2019 Oct 15;30(22):2750-2760. doi: 10.1091/mbc.E19-03-0146. Epub 2019 Sep 18.

Backbone

• Vector backbone: pspCas9(BB)-2A-Puro V2.0
• Backbone manufacturer: Addgene# 62988 from Feng Zhang
• Backbone size w/o insert (bp): 9200
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RhebL1 sgRNA
• Alt name: Ras Homolog Enriched In Brain-Like Protein 1 sgRNA
• Species: H. sapiens (human)
• Insert Size (bp): 20
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bbs1 (unknown if destroyed)
• 3′ cloning site: Bbs1 (unknown if destroyed)
• 5′ sequencing primer: TTTATGGCGAGGCGGCGG
• 3′ sequencing primer: gtgggcttgtactcggtcat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/513473v3 for bioRxiv preprint.