Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti CMV Puro DHFR.dn-cHSF1
(Plasmid #134729)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134729 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti CMV Puro Dest (w118-1)
  • Backbone manufacturer
    Eric Campeau, Paul Kaufman
  • Backbone size w/o insert (bp) 8022
  • Total vector size (bp) 9615
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DHFR.dn-cHSF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1593
  • Mutation
    Deletion of amino acids 186-202, 379−529
  • GenBank ID
    NM_005526.4
  • Entrez Gene
    HSF1 (a.k.a. HSTF1)
  • Promoter CMV
  • Tag / Fusion Protein
    • DHFR (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV Puro DHFR.dn-cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134729 ; http://n2t.net/addgene:134729 ; RRID:Addgene_134729)
  • For your References section:

    Transportable, Chemical Genetic Methodology for the Small Molecule-Mediated Inhibition of Heat Shock Factor 1. Moore CL, Dewal MB, Nekongo EE, Santiago S, Lu NB, Levine SS, Shoulders MD. ACS Chem Biol. 2016 Jan 15;11(1):200-10. doi: 10.1021/acschembio.5b00740. Epub 2015 Nov 19. 10.1021/acschembio.5b00740 PubMed 26502114