pAT1059_CMV/CAG_Flag-hNEIL2 (C291S)-PUFa-hTET1(CD)
(Plasmid
#134876)
-
Purpose3rd generation lentiviral expression of Flag-tagged Casilio-ME3.1 effector with C291S NEIL2 mutation hNEIL2(C291S)-PUFa-hTET1(CD) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134876 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX302
-
Backbone manufacturerPlasmid #25896
- Backbone size w/o insert (bp) 9573
- Total vector size (bp) 12546
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFlag-NEIL2(C291S)-PUFa-TET1(CD)
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)4614
- Promoter CMV/CAG
-
Tag
/ Fusion Protein
- Flag-NEIL2(C291S)-PUFa-TET1(CD) (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer agcagcgtatccacatagcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT1059_CMV/CAG_Flag-hNEIL2 (C291S)-PUFa-hTET1(CD) was a gift from Albert Cheng (Addgene plasmid # 134876 ; http://n2t.net/addgene:134876 ; RRID:Addgene_134876) -
For your References section:
Enhanced CRISPR-based DNA demethylation by Casilio-ME-mediated RNA-guided coupling of methylcytosine oxidation and DNA repair pathways. Taghbalout A, Du M, Jillette N, Rosikiewicz W, Rath A, Heinen CD, Li S, Cheng AW. Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7. 10.1038/s41467-019-12339-7 PubMed 31541098