pAT1089_PB-EF1a-Blast_2A_rtTA3-SV40pA_pCW-dCas9
(Plasmid #134895)

• Purpose: PiggyBac vector for establishement of doxycycline-inducible Sp dCas9 expression cell lines
• Depositing Lab: Albert Cheng
• Publication: Taghbalout et al Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7.

Backbone

• Vector backbone: pAT1502
• Backbone size w/o insert (bp): 11095
• Total vector size (bp): 13678
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HA-dCas9
• Species: Streptococcus pyrogenes
• Insert Size (bp): 4508
• Promoter: TET_ON (Dox inducible)
• Tag / Fusion Protein:
  • HA-dCas9 (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: taggcgtgtacggtgggagg
• 3′ sequencing primer: tagaaggcacagtcgagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry