Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pU6-(BsaI)_CBh-Cas9
(Plasmid #135010)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135010 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Zhang lab (Addgene plasmid # 42230)
  • Backbone size w/o insert (bp) 8508
  • Total vector size (bp) 8508
  • Modifications to backbone
    Sites for cloning sgRNA changed to BsaI. Sticky ends for cloning of sgRNA are the same as the original pX330 vector
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
    SpCas9
  • Alt name
    hSpCas9
  • Species
    humanized S. pyogenes
  • Insert Size (bp)
    4272
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed) (not destroyed)
  • 3′ cloning site EcoRI (not destroyed) (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Based on pX330 (Addgene plasmid 42230)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-(BsaI)_CBh-Cas9 was a gift from Yosef Shaul (Addgene plasmid # 135010 ; http://n2t.net/addgene:135010 ; RRID:Addgene_135010)
  • For your References section:

    Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Reuven N, Adler J, Broennimann K, Myers N, Shaul Y. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. 10.3390/biom9100584 PubMed 31597252